Job Status Waiting   Runing   Error
Start Cluster & Filter Genome Mapping non-miRNA Mapping Prediction Target Prediction Finish
Waiting Waiting Waiting Waiting Waiting Waiting
0:0:0
Cluster & Filter Result Details
Total reads were filtered by removing adaptor; then we clustered those identical reads into tags that we only keep one tags (including reads number); subsequently, we save those tags among specific lengths which are specified by user at submitting page. We use the tags we selected to do the following steps.
Waiting...
Genome Mapping Resultdownload
The selected tags are mapped to genome.
Waiting...
Non-miRNA Mapping Result Details
We use mapped tags in the previous step to map non-miRNA database which included non-miRNA ncRNA and mRNA.
Waiting...
Prediction Resultdownload
Click the digit on the right side of "Conserved miRNA" or "Novel miRNA" to see more information.

Target Prediction Resultdownload
Click the digit to see more information.
Submitted Parameters
Sequencing technology:  Solexa
Job type: miRNA
Submit time: 2011-03-28 17:29:08.0
Species: Homo sapiens.GRCh37.62(Human)
3' adaptor:  TCGTATGCCGTCTTCTGCTTG
Reads length:  18-30
miRNA Analysis Result
1.Job Status
You can see the current job status in this part.
2.Cluster & Filter Result
This part will show the result of "Cluster & Filter" process.
3.Genome Mapping result
The statistic of mapped and unmapped reads to genome will be displayed by pie chart.
4.Non-miNRA Mapping Result
The statistic of mapped and unmapped reads to non-miRNA database will be displayed by pie chart and different non-miRNA classes will be present in detail.
5.Prediction Result
The final result of miRNA analysis will be displayed in this part.
6.Target prediction Result
The result of target prediction be displayed in this part.
Job Summary Link
©BIG 2010, Beijing Institute of Genomics, Chinese Academy of Sciences
No.7 Beitucheng West Road, Chaoyang District, Beijing 100029, PR China