How using wapRNA for miRNA data analysis?
1.1  Sequencing platform choosing

wapRNA supports miRNA data analysis from SOLiD or Solexa sequencing platform, and we adopt different methods for analyzing these data. Users should choose the sequencing technology first.

Figure 1: A screen shot of sequencing platforms Back 

1.2  Data file uploading

miRNA analysis starts from raw data uploading. Raw data file should be in prescriptive format: csfasta for SOLiD or fastq for Solexa. The sequence file (eg. test.csfasta) and the corresponding quality file (eg. test.qual) both are requested. To save the uploading time, we only accept the compressed file (*.zip or *.tar.gz), and the total size of uploaded file should be less than 2GB.

Figure 2: A screen shot of raw data upload Back 

Examples for input file format
(1) csfasta format
>1279_6_61_F3
T300102110122020021202223233131010323111.1213322233
>1279_6_64_F3
T201302312122203001300011300301030313112.1210132001
>1279_6_81_F3
T203102113202103300003321320032000010112.2030021200
>1279_6_97_F3
T230123100123121321002211002200201000302.3310223100
>1279_6_145_F3
T331033013131233321013201203100311303310.3010023100
(2) qual format
>853_6_44_F3
8 6 6 9 22 18 4 8 5 20 8 11 21 8 5 23 6 11 23 7 2 15 16 5 7 20 13 14 6 10 8 21 18 22 16 6 21 17 7 7 5 27 21 15 5 6 6 5 8 2
>853_6_159_F3
6 8 10 4 5 22 24 6 11 7 26 23 13 11 16 8 8 5 5 8 13 8 7 11 4 6 8 8 3 5 7 8 7 5 10 4 2 11 10 24 2 3 5 14 8 6 2 2 5 24
>853_6_399_F3
4 14 8 27 6 7 8 11 3 16 13 26 14 3 11 21 4 22 5 24 5 11 5 7 20 26 5 4 8 22 9 8 3 2 25 15 24 16 11 23 14 10 4 11 16 7 6 17 13 11
>853_6_606_F3
12 25 5 16 11 12 12 8 8 6 8 4 4 12 2 5 13 4 4 5 9 4 5 7 11 9 5 8 20 21 8 12 5 16 19 13 8 5 16 20 18 5 17 11 8 20 18 13 5 13
>853_6_639_F3
4 2 13 3 6 2 18 3 6 7 16 16 3 5 9 9 13 6 11 11 11 19 3 14 3 13 23 8 5 8 8 5 4 9 23 8 8 8 15 2 8 20 8 4 2 8 11 12 8 6
(3) fastq format

@3_B2SbLmlF321/1
ACAGGTTTAAAAATGTTTTATAAAGTGCTAAAGTTGTGTTTAAA
+
hhXhhhhhabghKhh_hhhhhZQNhRh^]KPIhP[hLhKVRLDH
@5_H4SbLmlF321/1
ATACATTTCTTCAATACTAAAATCATTAACTACAAGTTGTTTAA
+
hhhhhhhhhhhhh`hhhha^h[hNfgY_SNMKSVFQKRPNIPMM
@1_z0SbLmlF321/1
GTTTCTTAGGCAGAAAAGAAGGAACGAAAGAGTTAACTCATATT
+
hhhhhhhhhhfThhh^ZhRUhaWaVhUPShHhRNGSNSKKXIVS
@7_IyRbLmlF321/1
ATCGTTTCCTAGTGCATCAATGAAAGGTTTTAAAGTAGCTACTG
+
\hbhbhhfbh]h\hffh]WOhhTOOcSM[dhMNBPFQUHRIBRV

Back 

1.3  Reference sequence choosing

In the current version, the following ten model organisms¡¯ genome sequences download from ENSEMBL database were provided and users could analyze directly.

  • Homo sapiens (ENSEMBL 62, GRCh 37)
  • Mus musculus (ENSEMBL 62, NCBI 37)
  • Rattus norvegicus (ENSEMBL 62, GRSC 3.4)
  • Caenorhabditis elegans (ENSEMBL 62, WS220)
  • Danio rerio (ENSEMBL 62, Zv9)
  • Macaca mulatta (ENSEMBL 62, MMUL_1)
  • Pan troglodytes (ENSEMBL 62, CHIMP2.1)
  • Gallus gallus (ENSEMBL 62, WASHUC 2)
  • Drosophila melanogaster (ENSEMBL 62, BEGP5.25)
  • Sus Scrofa (ENSEMBL 62 Sscrofa9)

Users must choose the corresponding reference for your sample data

Figure 3: A screen shot of Reference Preparation. Back 

1.4  Advanced option

wapRNA adopts different strategies for miRNA data analysis from SOLiD and Solexa sequencing platforms (illustrated in the following figure).

Figure 4: The pipline of miRNA analysis.

(A) SOLiD miRNA data

For SOLiD data with default parameters, we will trim 3¡¯ adapter sequence and align the raw reads to the non-miRNA sequences. Then, we align those non-mapped reads to the miRNA precursor sequences from miRBase and annotate known miRNA. Next, the remaining reads are aligned to the genome and we got their precursor sequences, which help to predict novel miRNAs using primary sequence and second structure (See figure 5).

Figure 5: A screen shot of the SOLiD Advanced Options.

(B) Solexa miRNA data

For miRNA data, when user finished setting the required parameters and submitted jobs, wapRNA will automatically computing and analyzing. When the required job finished, system will notify users by sending an email message(See figure 6).

Figure 6: A screen shot of the Solexa Advanced Options. Back 

©BIG 2010, Beijing Institute of Genomics, Chinese Academy of Sciences
No.7 Beitucheng West Road, Chaoyang District, Beijing 100029, PR China