FAQ
(1) What dose wapRNA do ?
wapRNA maps user-designated short reads to the user-defined references, gives gene annotation results and quantifies gene expression level, provides three types functional analysis. It is now specifically designed for Illumina-Solexa/AB-SOLiD reads, not for 454 or capillary ones.
(2) What is the most important thing I should understand before uploading the reads sequence?
Before upload the reads sequence, you must understand the file format.
The SOLiD reads are in csfasta format, like:
>reads name
Sequence

For example:
>28_59_26_F3
T0020211032101213303000333
>28_59_78_F3
T0120021102011232221103202

The Solexa reads are in fastq format, like:
@reads name
Sequence
+reads name
Quality sequence

For example:
@HWUSI-EAS762:8:1:2411:1150#0/1
CCATTGATTCAGAAGCCATAAGTGCACTAGTGAAATTGATGAATAAGTCAATAGAGGGGACAGCAGATGATGAAGAGGAGG
+
gggdgggfffgaggagg\agff]ffacdffdgfefgg_ggcddcfdfffafgcgcfdffc[ddd[dWJ``^dRKYOa`V^f

Make sure the file format is correct£¬all the files should be compressed (*.zip or *.tar.gz) before upload, the size of each file must be less than 1GB, and the total size of the files must be less than 2GB.
(3) When need I to do reads filter?
The reads filter is an optional function, if your reads have a lot of low quality score(average score for each base), for example more than 20% of reads quality lower than 8, we suggest you need to do reads filter first.
(4) What can I do, if the reference was not listed into the dropbox?
In the current version, we only integrated 10 frequently-used species, If you have other requirement, please inform us via rnatap@big.ac.cn.
(5) What kind of mapping software used in this web service??
For mRNA pipeline, using Corona_Lite for SOLiD and BWA for Solexa. For miRNA pipeline, using RNA_map for SOLiD and BWA for Solexa.
Particularly, We implemented the Corona_Lite mapping in a recursive manner that reported in (Cloonan, Forrest et al. 2008).
(6) What happens for no matching results?
The mapping procedure needs about thirty minutes for 100M human short reads. If the running time is much longer, perhaps the server¡¯s cluster is busy and the jobs are in queue state. Please give it more time.
(7) Can I uploading existing data to do functional analysis?
Yes, we have designed the "Functional Analysis" column, you can find the integrated software in that page.
(8) Why some conserved miRNA can¡¯t be found in miRBase?
Some conserved miRNA are not existent in miRBase, because we identified them as conserved miRNA if they have similar miRNAs in miRBase and suitable second structure.
(9) How long reads should be analyzed in miRNA analysis?
We recommend the reads of 15~35 length be analyzed in miRNA analysis because most of miRNA in miRBase are in this range.
(10) Are mapping errors allowed within the microRNA section? They should be allowed, since microRNAs are well known candidates for RNA editing.
NO, mapping errors are not allowed within the microRNA section. Although the RNA editing is well known, a more strict criteria should be used for most miRNA analysis.
(11) What database was used for mRNA annotations?
We used ENSEMBL database for mRNA annotation.
(12) What database was used for the "conserved" microRNA annotations? What does "conserved" mean here?
miRBase was used for the conserved-microRNA annotation. The candidate novel miRNAs predicated using miRDeep was classified according to the miRBase annotation. That is, if the seed sequence (2-8 base pair) of a novel miRNA is same to miRBase mature sequences, this novel miRNA was denoted to be conserved.
(13) The reads are mapped to a "non-miRNA database". What databases are used here? Did you predict the ncRNAs on your own? What tools were used?
The non-miRNA database here is consisting of mRNA, tRNA, rRNA, snRNA, snoRNA or other structure RNAs. We did not predicate the ncRNAs. All these ncRNA were extracted from Rfam, RNAdb and GenBank databases.
(14) With recent advancements in the technology, researchers working on RNAseq often go for paired-end sequencing. How wapRNA would be able to handle this?
wapRNA is designed and implemented for general and elementary analysis of an mRNA or miRNA project. For mRNA data, wapRNA will provide user the reads mapping information, gene expression value mainly. So when researchers working on RNAseq for paired-end sequencing, they can upload the single end reads or the combined reads. Of course, we will consider improvement usage of this point in the near future.
(15) ¡°Filter parameters¡± submission step: For the reads, having one or more bases below the user-specified quality threshold, are they discarded or given less weight while mapping? If former being the case, the user might lose part of the sequence data, which could have been otherwise useful.
The average quality of each read is calculated and below the user-specified threshold reads will be discarded for mRNA expression annotation. Generally, if one read have low average quality score, the matching probability is very low, but this option in the web page is optional, if those low-quality reads is useful users should not select this parameter.
©BIG 2010, Beijing Institute of Genomics, Chinese Academy of Sciences
No.7 Beitucheng West Road, Chaoyang District, Beijing 100029, PR China